Angiotensin-Converting Enzyme Insertion/Deletion Gene Polymorphism and Progression of Chagas' Cardiomyopathy

INTRODUCTION

Chagas' disease, caused by Trypanosoma cruzi, affects around 15 million persons, and is associated with 20 000-50 000 deaths annually.^1,2 Although it is native to America, migration has taken the disease to other regions.^1,2 The disease involves an acute phase of fever and adenopathy, followed by a chronic phase, frequently characterized by cardiac lesions (20%-30%), a long time after parasite entry.^1,3 Not all patients develop chagasic cardiomyopathy, and when it does occur it does not follow a definite pattern, even though the environment may be similar; this implies that progression cannot be explained solely by environment.^1,3 Factors contributing to disease progression should be differentiated from those of its contraction, as the latter depend on exposure and the former depend on other variables, including genetic variables.⁴

T cruzi itself presents considerable genetic variability⁴ related to its pathogenic potential. Thus, its interaction with the human species varies, but it is precisely human susceptibility which is least understood,⁴ and for this reason the genetic factors of disease progression require to be studied. Exploration of the possible link with genotypes of the renin-angiotensin system (RAS) proves interesting, with respect to which relationships to manifestations of heart disease^5-7 and therapeutic response have been published.⁶

For this reason, this study was oriented towards determining whether a human genetic variation in the RAS known to be related to heart disease (insertion/deletion polymorphism [I/D] of the angiotensin-converting enzyme [ACE] gene) is associated with the course of Chagas' disease.

METHODS

We undertook an explanatory field study, which also employed case-control methods as it began with the "absence" (controls, stages la-lb) or "presence" (cases, stages II and III) of the event of interest, to retrospectively investigate risk factors. The population included seropositive patients registered with the Molecular Cardiology Laboratory of the Central University of Venezuela. The sample was non-probabilistic. Blood samples were taken over a period of 6 months.

Procedures

Data were obtained primarily through revision of medical charts. The I/D polymorphism was confirmed, as previously described,⁵ with 100 ng of genomic DNA, 50 pmol of primer (5'CTGGAGACCACTCCCATCCTTTCT3' and 5'AGACTGCTTACACTACCGGTGTAG3') and 2 U of Taq polymerase (denaturalization: 94°C, 5 min [x 1]; denaturalization: 94°C, 1 min; alignment: 58°C, 1 min; extension: 72°C, 2 min [x 30]; final extension: 72°C, 5 min [x 1]). Two fragments of 490 base pairs for genotype II, 2 of 190 pairs for DD, and 1 of each type for ID were obtained. The products were visualized using agarose electrophoresis, stained with ethidium bromide, and compared with the respective scales.

Data Analysis

The dependent variable was the stage of heart disease, according to Hagar et al.³ Firstly, Hardy-Weinberg equilibrium was confirmed by trinomial agreement (allele frequency D)² + 2 x (allele frequency D) xv(allele frequency I) + (allele frequency I)². The χ² test was used to determine the cited equilibrium. Logistic regression analysis was used to determine the risk of advanced chagasic cardiopathy, including age and sex as intervening variables.

Three types of genetic expression were used⁷:

- DD codominance: DD genotype =1; II genotype =0; ID genotype =0.5

- DD dominance: DD and ID genotypes =1; II genotype =0

- DD recessivity: DD genotype =1; II and ID genotypes =0

The final result is shown as an odds ratio with the respective 95% confidence interval (CI). Data analysis was performed using the programs Microsoft Excel 2000 and Statistix, version 1.0.

RESULTS

The sample included 34 patients with genotype II (27.2%), 41 DD (32.8%), and 50 ID (40%), whose clinical characteristics are shown in Table 1. The trend towards linkage disequilibrium was not significant (P=.09). The mean age of the patients was DD, 59.32 (8.88) years; II, 61.86 (9.17) years; and ID, 59.76 (9.45) years. The percentage of male patients with DD, II, and ID genotypes was 46.34%, 58.82%, and 50%, respectively.

Table 2 shows the results of the logistic regression analysis, with age and sex always exhibiting a similar profile. The D allele was associated with an advanced degree of chagasic cardiomyopathy, although the results were not significant.

DISCUSSION

In this study the progression of Chagas' disease was correlated with a genetic characteristic of the RAS, given that characteristics such as these can modify the progression of parasitic diseases.^6,7 For Chagas' disease, however, information is scarce, but its relationship with polymorphic residuals of the human histocompatibility complex has been published^8,9; in our case, an important limitation was the small sample size, in addition to the fact that only 2 intervening variables were considered, sex and age, although the clinical characteristics of the patients were more or less typical.^1,3

A possible association of the D allele of the ACE gene I/D polymorphism with advanced degrees of cardiomyopathy has been implied. Should this be the case, there would be 2 conflicting explanations: that the D allele is, in fact, associated with progression, such that it would tend to be rapid, or that the D allele is associated with protection against death in advanced stages, which would last longer ("survival bias"). The first appears to be the most likely option and, in fact, a study by Nakahara et al¹⁰ demonstrated higher heart weight in DD individuals, in correlation with the study by Montgomery et al,¹¹ who observed an association between higher ventricular hypertrophic response and exercise; this coincides with other studies in which hypertrophy is associated with the DD genotype.¹¹ The second possibility, however, cannot be excluded. For example, Sanderson et al¹² found no association between the I/D polymorphism and heart failure, and van Suylen et al¹³ reported a protective relationship between the DD genotype and ventricular hypertrophy.

The logical explanation of the association between RAS genotypes and heart disease involves changes in plasma concentrations of the mediators,^10,13 but this association might not exist if the local formation of angiotensin II and/or the responses of different organs are altered.⁶ The genotype profile could predict the response of the patient to treatment and make its optimization possible; Kuznetsova et al⁵ established that the deleterious effect of the DD genotype increases in the absence of pharmacotherapy and is mitigated with it.

In conclusion, the I/D polymorphism of the ACE gene is not related to progression of chagasic cardiomyopathy, although this must be confirmed in further studies.

---

Correspondence: Dr. C. Pascuzzo-Lima.
Sección de Farmacología. Decanato de Ciencias de la Salud Dr. Pablo Acosta Ortiz. Universidad Centroccidental Lisandro Alvarado.
Avda. Libertador con Avda. Andrés Bello, 3001 Barquisimeto. Lara. Venezuela.

E-mail: [e-mail]

Received March 23, 2008.
Accepted for publication May 21, 2008.